Foxys

Immunohistochemiczne diagnoza …

Immunohistochemiczne diagnoza ...

tło

Celem tego badania było określenie potencjału diagnostyczną immunohistochemiczną, wykorzystująca przeciwciała do wydzielonego antygenu prątkowego MPT64, w jamie brzusznej i węzłów chłonnych tuberculosis.

metody

Użyliśmy utrwalone w formalinie histologicznie rozpoznano gruźlicę brzusznej (n = 33) i szyjki macicy gruźlicze zapalenie węzłów chłonnych (n = 120) biopsje. Problemy te przeanalizowano stosując kombinację metody Ziehl-Neelsen, kultury immunohistochemię z przeciwciałem przeciwko MPT64, specyficzny dla antygenu Prątek gruźlicy złożonych organizmów. Brzucha i szyjki biopsji węzłów chłonnych od chorób niż prątki (n = 50) badano podobnie jako kontrole negatywne. Immunohistochemii z użyciem dostępnego w handlu przeciw BCG i zagnieżdżonego PCR dla IS6110 wykonano dla porównania. Nested PCR była dodatnia w 86,3% przypadków oraz wyniki wszystkich testów porównano za pomocą zagnieżdżonego PCR jako złoty standard.

wyniki

W chłonnych biopsji węzłów, immunohistochemiczne z przeciwciałami MPT64 był dodatni u 96 (80%) przypadkach oraz 4 grupy kontrolnej (12,5%) i anty-BCG 92 (76,6%) i 9 (28%), odpowiednio. Wyniki dla przypadków i kontroli w biopsji jamy brzusznej 25 (75,7%) i 2 (11,1%) anty-MPT64 i 25 (75,7%) i 4 (22%) anty-BCG. Ogólna czułość, swoistość, dodatnia i ujemna wartość predykcyjna immunohistochemii z anty-MPT64 92%, 97%, 98% i 85%, odpowiednio, podczas gdy odpowiednie wartości dla anty-BCG 88%, 85%, 92%, i 78%.

Wniosek

Immunohistochemii stosując anty-MPT64 jest prosta i czułą techniką ustanowienie szybkiego i specyficzne rozpoznanie M. tuberculosis Zakażenie i który może być z łatwością wkomponowany rutynowe laboratoria histopatologicznych.

tło

Extra-płucnej gruźlicy (EPTB) stanowi około 10-15% wszystkich zakażeń gruźlicą i występuje nawet u 50% chorych z ludzkim wirusem niedoboru odporności (HIV) -tuberculosis koinfekcji [1 – 3]. Roczne Częstość występowania EPTB wzrosły nie tylko w krajach rozwijających się, ale na całym świecie w ciągu ostatnich kilku lat [1. 2. 4].

Podczas gdy, Prątek gruźlicy jest najczęstszym środkiem wywołującym EPTB częstość występowania niż prątki gruźlicy rośnie z lub bez zakażenia HIV, w zakresie od 3,8 do 50% w różnych częściach świata [7 – 9]. Jako leczenie jest różna dla tych dwóch warunków, ważne jest, aby ostateczne diagnozy. Jednak w obszarach świata, gdzie choroba ta ma charakter endemiczny, mniej niż połowa otrzymuje dokładną diagnozę prowadzącą do niewłaściwego leczenia empirycznego [10 – 12].

Niniejsze badanie zostało przeprowadzone w celu dalszej oceny potencjału diagnostycznego barwienia immunohistochemial wykryć MPT64 użycie większego rozmiaru próbki z różnych populacji, a tym inne strony. Utrwalone w formalinie zatopione w parafinie biopsji od pacjentów z gruźlicą brzucha i gruźlicze lympadenitis badano a działanie anty-MPT64 porównano z dostępnym w handlu przeciw BCG.

metody

Pod względem histologicznym rozpoznano gruźlicę brzusznej (n = 33) i szyjki macicy gruźlicze zapalenie węzłów chłonnych (n = 120) biopsje otrzymano z Zakładu Patologii Szpitala, Ujjain Ujjain w Indiach w okresie od lipca 2004 do marca 2006. Kategorie diagnostyczne zawarte w studium o wypadkach i kontrole są pokazane w tabeli 1. biopsji kontroli uzyskano ze Szpitala Ujjain, a także Zakładu Patologii Szpitala Uniwersyteckiego w Haukeland, Bergen, Norwegia. Dwie próbki gruźlicy płuc biopsji z archiwum z licznymi AFB na barwieniu ZN zostały wykorzystane jako znany kontroli pozytywnej w razie potrzeby.

badane kategorie diagnostyczne okazów.

* Brak Associated uszkodzenie jelit widział.

# Wszystkie ziarniniak ciało obce były biopsji skóry.

Biopsji od pacjentów z gruźlicą płucną, kortykosteroidami, terapia immunosupresyjna zostali wykluczeni z badania. Szczegółowe wywiad i badanie kliniczne rezultaty zostały uzyskane z rejestrów klinicznych lub od pacjentów. Większość pacjentów chłonnych przedstawiono o masie szyi, a gruźlica brzucha głównie związane z bólem brzucha. Świadoma pisemna zgoda uzyskano i pacjenci byli zapewnić poufności. Uzyskano aprobatę etyczną z komisji etycznej instytucjonalnych na Ujjain szpitala i regionalnych komitetów etycznych zarówno w Norwegii i Indii. U wszystkich pacjentów zbadano pod względem HIV.

Kultura, barwienie ZN & Badanie histopatologiczne

immunohistochemia

Zagnieżdżone Reakcja łańcuchowa polimerazy dla IS6110

Ekstrakcja DNA i zagnieżdżonego PCR skrawków parafinowych były wykonywane, jak opisano wcześniej [14]. Krótko mówiąc, proteinazy K po trawieniu genomowego DNA bakterii eluuje wodą z zastosowaniem zestawu MagAttract DNA M48 Mini (Qiagen, West Sussex, UK) w Biorobot M48 (Oiagen). 123 par zasad fragment IS6110 amplifikowano przy użyciu następujących starterów 5 ‚CCTGCGAGCGTAGGCGTCGG 3’ i 5 ‚CTCGTCCAGCGCCGCTTCGG 3’. Produkt poddano drugiej rundzie amplifikacji PCR z użyciem starterów 5 ‚TTCGGACCACCAGCACCTAA 3’ i 5 ‚TCGGTGACAAAGGCCACGTA 3’ do amplifikacji 92 par zasad fragmentu. Mieszanina PCR składała się z 5 ul DNA wymyto 25 jil HotStarTaq Master Mix (Qiagen), 0,25 uL 100 uM roztworu każdego startera stanie, woda destylowana do objętości końcowej 50 ul. Dla zagnieżdżonego PCR, 1 | il pierwszego produktu PCR użyto jako matrycę. Cykl reakcji w pierwszym PCR – 94 ° C przez 1 minutę, 68 ° C przez 1 minutę, 72 ° C przez 20 sekund, 45 cykli i zagnieżdżonego PCR – 94 ° C przez 1 minutę, 58 ° C przez 1 minut, 72 ° C przez 20 sekund w 35 cyklach. Zarówno PCR miał etapowi wstępnej aktywacji cieplnej w temperaturze 95 ° C przez 15 minut, a końcowe wydłużanie w 72 ° C przez 10 minut. Amplifikowany produkt analizowano na 3% żelu agarozowym wybarwionym bromkiem etydyny. Prątkowy DNA i dodatnie produktu PCR włączono jako kontrolę pozytywną oraz sterowanie ekstrakcji (ze wszystkich etapów, lecz bez jakiejkolwiek tkanki), probówki reakcyjnej zastąpienia wody destylowanej dla szablonu testowej i próbce uprzednio uzyskanych wynik negatywny w reakcji PCR były następujące jako kontrolę ujemną włączono do każdego cyklu PCR.

Analiza danych

wyniki

W sumie 203 biopsji badano. Wszyscy pacjenci byli ujemna HIV.

Kwas szybki mikroskopia bakterii i Kultura (tabela 2)

Badanie histopatologiczne

w biopsji z jamy brzusznej i węzłów chłonnych przypadkach Obie dobrze zorganizowane i źle zorganizowane ziarniniaki zaobserwowano. Gruźlica brzusznej wszystkie krezkowe węzły chłonne obserwowano dobrze zorganizowany nekrotyczne ziarniniaków w ścianie jelit, martwicze ziarniniaki zaobserwowano w 58% przypadków, podczas gdy w innych przypadkach nie miał martwicze ziarniniaki z lub bez zwłóknienia.

Węzły chłonne wykazywały typowe dobrze zorganizowane ziarniniaków w 70% przypadków, mieszane w 18% i słabo zorganizowane w 12% przypadków. Dziewięćdziesiąt procent przypadków wykazały martwicę jednak zarówno martwicze i bez martwicy ziarniniaki często widoczne w tym samym rozdziale.

immunohistochemia

IHC anty-MPT64 był dodatni u 14 (73,7%), 7 (77,7%) i 4 (80%) przypadkach od ściany jelit, otrzewnej i krezkowych węzłów chłonnych odpowiednio i 2 grupy kontrolnej (11%). Podobnie, odpowiednie wyniki dla anty-BCG u 15 (78,9%) 6 (66%), 4 (80%) odpowiednio dla przypadków, a 4 (22%) dla grupy kontrolnej (Tabela 2). W chłonnych biopsji węzłów, IHC anty-MPT64 był dodatni u 96 (80%) przypadkach i 4 (12,5%), podczas gdy kontrole anty-BCG był dodatni u 92 (76,6%) przypadkach, a 9 kontrolnej (28,1%).

Porównanie tych dwóch przeciwciał patrząc w procentach wybarwionych komórek i natężenie zabarwienia w stosunku do martwicy i organizacji ziarniniaków przedstawiono w tabeli 3 i na Figurach 1 i 2. W dobrze zorganizowanych ziarniniaków, odsetek komórek wybarwionych (s = 0 · 04), a intensywność zabarwienia (+2 lub +3, p = 0,001) była znacząco wyższa niż MPT64 anty-anty-BCG. Nie stwierdzono istotnej różnicy odsetka barwienia lub intensywności wykryto między dwóch przeciwciał w źle zorganizowanych ziarniniaków. Nie-martwiczych ziarniniaków procent komórek dodatnich (p = 0,02) oraz intensywnością barwienia (p = 0,03) była znacząco wyższa dla anty-MPT64 niż anty-BCG. W martwiczych ziarniniaków intensywność barwienia anty-MPT64 była wyższa, lecz nie było znaczącej różnicy między odsetkiem komórek wybarwionych pomiędzy dwoma przeciwciałami.

Lokalizacja i wzór ekspresji dwóch przeciwciał zróżnicowane. Barwienia anty-MPT64 obserwowano głównie w komórkach zapalnych. Te centra martwicze były na ogół ujemne, z wyjątkiem 8% martwiczych ziarniniaków w którym zostały wykryte, ale sporadyczne silne sygnały. Barwienie wzór był głównie granulowany anty-MPT64. Anty-BCG sygnały pozytywne wykryto zarówno w środku i martwiczych komórek zapalnych u wszystkich martwiczych ziarniniaków. W przeciwieństwie do przeciwciał anty-MPT64, wzorzec barwienia anty-BCG był głównie rozproszona (fig. 2. 3).

Wykonanie dwóch przeciwciał w olbrzymich komórek oceniano oddzielnie. W przeciwieństwie do komórek nabłonka, nie było istotnych różnic w odsetku komórek olbrzymich wybarwiono albo przeciwciał. Niemniej jednak, intensywność barwienia anty-BCG z komórek olbrzymich słaby w stosunku do anty-MPT64 (fig. 2c, 2f).

Reakcja łańcuchowa polimerazy

Wyniki testu IS6110 PCR przedstawiono w tabeli 2. Ogólna PCR dodatniego wyniku 132/153 (86,6%) w histologcally zdiagnozowanych przypadków gruźlicy. Spośród nich, w ośmiu przypadkach były pozytywne po pierwszej amplifikacji PCR, natomiast większość (n = 124) tylko na dodatnie zagnieżdżonej reakcji PCR. Przypadki, które były pozytywne z pierwszego biegu PCR miał wyższy procent anty-MPT64 zabarwionych komórek. Wszystkie kontrole dodatnie były dodatnie w obu pierwszym uruchomieniu PCR i zagnieżdżonego PCR.

Porównanie i walidacja wyniku różnych testów

walidacja diagnostyki różnych testów przy użyciu zagnieżdżone PCR jako złoty standard (wszystkie wartości są w procentach).

Porównanie szyjnego węzła chłonnego i brzucha próbek tkanek dla różnych testów

W gruźlicze zapalenie węzłów chłonnych czułość ZN barwienia (13%) i kultury (25%) był wyższy niż w gruźlicy brzusznej (0% i 12,5%, odpowiednio). Czułość IHC obu przeciwciał była wysoka i nie było znaczącej różnicy między szyjnych węzłów chłonnych, gruźlicę i różnych stron gruźlicy brzusznej. Specyficzność przeciwciała anty-BCG było jednak 60% w ścianie jelita w porównaniu do 86% i 92,3% w szyjnych węzłów chłonnych krezkowych węzłów chłonnych i odpowiednio. W przeciwieństwie do tego, specyficznością MPT64 była bardzo wysoka i stwierdzono, że wynosi 100% ściennych i krezkowe węzły chłonne jelitowe i 98% w węzłach chłonnych, szyjki macicy (tabela 4).

Dyskusja

Istnieje kilka doniesień opisujących zastosowanie IHC w diagnozie gruźlicy (14). Jednakże, w tym badaniu pokazują, że przy użyciu antygenu, przeciwko wydzielniczej mykobakterii MPT64 antygen, to jest możliwe uzyskanie stałej, wysokiej czułości (89-93%) i specyficznością (95-98%) IHC na różne rodzaje tkanek. Siłą tej technologii jest to, że jest solidny, łatwo dostępne w rutynowych laboratoriach patologii chirurgicznej i może wykryć prątki gruźlicy pofragmentowane [19]. W porównaniu z ZN barwiącej, która ma czułość 10-45% [19], ale wymaga nienaruszoną ścianę komórkową technika ta oferuje znaczną poprawę możliwości diagnostyki i powinny być dostosowane do diagnozowania pauci-bakteryjna EPTB. IHC gruźlicy jest jednak dużo wolniej, gdy rutynowe metody diagnostyczne w laboratoriach histopatologicznych, prawdopodobnie z powodu braku specyficznego przeciwciała anty-mykobakterii odpowiedni dla wszystkich typów tkanek 5. 14. [16], a tym samym dokładnie diagnostyczne rola dla IHC M. tuberculosis musi być oceniona w odpowiednich grupach kontrolnych i przy odpowiednim surowic odpornościowych na terenach endemicznych. Bogata Badanie to pierwszy wykazać, że IHC przeciwciała do MPT64 jest wystarczająco mocny, aby ustalić etiologiczny diagnozę M. kompleks gruźlicy Zakażenie w różnych typach tkanek EPTB.

Nasze wyniki wskazują, że IHC anty-MPT64 ma lepszą specyficzność, czułość i wartości predykcyjnej niż przeciw BCG (tabela 4). Było to szczególnie widoczne w ścianie jelita, gruźlica, w którym anty-MPT64 wykazała 100% specyficzności w porównaniu z 60% dla anty-BCG (tabela 3). Przeciwciała anty-MPT64 dała ostre i silne sygnały z jasnym tle w porównaniu z przeciwciałami anty-BCG dokonywania interpretacji łatwiejszy i umożliwiając bardziej pewni diagnozy M. tuberculosis złożonym organizmem. Dolna swoistość anty-BCG może być spowodowana reaktywnością krzyżową z innymi organizmami zakaźnymi, jak opisano wcześniej [20 – 22].

Wniosek

Wykazaliśmy, że IHC z przeciwciałem do MPT64, wydzielanego antygen swoisty dla M. tuberculosis złożone jest specyficzne i czułe technik diagnozowania EPTB. To jest tanie, niezawodne i szybki sposób, który można stosować w rutynowej laboratorium w celu zapewnienia efektu w ciągu jednego dnia pracy i zapewnia wczesne stosowanie terapii. Są specyficzne anty-MPT64 byłyby cenne w różnicowaniu M. tuberculosis od innych organizmów, zwłaszcza zakaz prątki gruźlicy i innych ziarniniakowe zapaleń.

deklaracje

Podziękowanie

Jesteśmy wdzięczni dr V.K. Mahadik, dyrektor R.D. Gardi Medical College za zachętę i wsparcie podczas tej pracy. Jesteśmy wdzięczni wszystkim techników laboratoryjnych Ujjain szpitala za ich wsparcie w zbieraniu danych i Gerd Lillian Hallseth i Randi L. Nygaard do wytycznych technicznych. Z wdzięcznością potwierdza prof Laurence Albert Bindoff za jego konstruktywne komentarze i korekty językowej. Stan Edukacja Fundusz Pożyczkowy, Norwegia i Helse-Vest i norwescy ufa dla finansowania badań finansowanych-tego badania.

Oryginalne złożone pliki obrazów dla autorów

Poniżej znajdują się linki do oryginalnych plików złożonych autorów dla obrazów.

Department of Thoracic Medycyny Szpitala Uniwersyteckiego w Haukeland

Referencje

  1. Małe PM, Schecter GF Goodman PC, Sande MA, Chaisson RE, Hopewell PC: Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim wirusem niedoboru odporności. N Engl J Med. 1991, 324 (5): 289-294. Zobacz artykuł PubMed Google Scholar
  2. Clark RA, Blakley SL, Greer D Smith MH, Brandon W, Wiśniewski TL: Krwiopochodne rozpowszechnianie Mycobacterium tuberculosis u pacjentów z AIDS. Rev Infect Dis. 1991, 13 (6): 1089/92. Zobacz artykuł PubMed Google Scholar
  3. Seibert AF, Haynes J Middleton R, Bass JB: Gruźlicze wysięk. Dwadzieścia lat doświadczenia. Klatka piersiowa. 1991, 99 (4): 883-886. 10,1378 / chest.99.4.883. Zobacz artykuł PubMed Google Scholar
  4. Galkin VB, Iagafarova RK, Khokkanen VM, Grashchenkova OV: [Badania epidemiologiczne i kliniczne aspekty gruźlicy pozapłucnej w Północno-Zachodniej Rosji]. Probl Tuberk. 1998, 36-38. Google Scholar
  5. Ulrichs T Lefmann M, Reich M, Morawietz L Roth A, Brinkmann V Kosmiadi GA, Seiler P Aichele P, Hahn H Krenn V Gobel UB, Kaufmann SH: Modified barwienie immunohistologiczne umożliwia wykrywanie Ziehl-Neelsen-ujemne Mycobacterium tuberculosis organizmów i ich dokładna lokalizacja w tkance ludzkiej. J Pathol. 2005, 205 (5): 633-640. 10,1002 / path.1728. Zobacz artykuł PubMed Google Scholar
  6. Perkins MD, Roscigno G Zumla A: Postęp w kierunku poprawy diagnostyki gruźlicy dla krajów rozwijających się. Lancet. 2006, 367 (9514): 942-943. 10,1016 / S0140-6736 (06) 68386-4. Zobacz artykuł PubMed Google Scholar
  7. Mfinanga SG, Morkve O Kazwala RR, Cleaveland S Sharp MJ, Kunda J Nilsen R: mykobakteryjnymi adenitis: rola Mycobacterium bovis, niż prątki gruźlicze, zakażenia HIV i czynników ryzyka w Arusha, Tanzania. Wschód Afr Med J 2004, 81 (4): 171-178. Zobacz artykuł PubMed Google Scholar
  8. Jindal N, Devi B, Aggarwal A: mykobakteryjnymi chłonnych szyjnych w dzieciństwie. Indian J Med Sci. 2003, 57 (1): 12-15. PubMed Google Scholar
  9. Evans MJ Smith NM, Thornton CM, Youngson GG, Szary ES: atypowe zapalenie węzłów chłonnych u dzieci – clinicopathological badanie 17 przypadków. J Clin Pathol. 1998, 51 (12): 925-927. PubMed Central Zobacz artykuł PubMed Google Scholar
  10. Mfinanga SG, Morkve O Sviland L, Kazwala RR, Chande H Nilsen R: Pacjent wiedzy, praktyki i wyzwania dla systemu opieki zdrowotnej we wczesnym diagnozowaniu prątków adenitis. East Afr Med J. 2005, 82 (4): 173-180. Zobacz artykuł PubMed Google Scholar
  11. Aggarwal P Wali JP Singh S, R Handa, peruka N, Biswas A: badanie kliniczno-bakteriologiczne obwodowego gruźlicze zapalenie węzłów chłonnych. J Assoc Lekarze Indie. 2001, 49: 808-812. PubMed Google Scholar
  12. Udwadia ZF: Kontrola gruźlicy w Indiach. N Engl J Med. 2003, 348 (8): 758-9; Autor odpowiadać 758-9. 10,1056 / NEJM200302203480817. Zobacz artykuł PubMed Google Scholar
  13. Furak J Trojan I Szoke T Tiszlavicz L, K Boda, Balogh A Roth E: [histologiczne i immunohistochemiczne struktura płuc tuberculotic ziarniniaków w przypadkach nieleczonych i leczonych przypadkach leki przeciwgruźlicze]. ORV Hetil. 2003, 144 (27): 1347/52. PubMed Google Scholar
  14. Mustafa T Wiker HG, Mfinanga SG, Morkve O Sviland L: immunohistochemiczne z użyciem kompleksu Mycobacterium tuberculosis specyficzne przeciwciała dla lepszego rozpoznania gruźliczego zapalenia węzłów chłonnych. Mod Pathol. 2006, 19 (12): 1606/14. 10.1038 / modpathol.3800697. Zobacz artykuł PubMed Google Scholar
  15. Mustafa T Phyu S, Nielsen R Jonsson R Bjune G: mysim modelu wolno postępującą podstawowej tuberculosis. Scand J Immunol. 1999, 50 (2): 127-136. 10,1046 / j.1365-3083.1999.00596.x. Zobacz artykuł PubMed Google Scholar
  16. Sumi MG, Mathai A, Ruben S, Sarada C, Radhakrishnan VV: Metoda immunocytochemiczna wczesnej diagnostyki laboratoryjnej gruźliczego zapalenia opon mózgowych. Clin Diagn Lab Immunol. 2002, 9 (2): 344-347. 10,1128 / CDLI.9.2.344-347.2002. PubMed Central PubMed Google Scholar
  17. Barbolini G Bisetti A Colizzi V Damiani G Migaldi M, Vismara D: immunohistologiczne analiza prątków antygenów przez przeciwciała monoklonalne w gruźlicy i mycobacteriosis. Hum Pathol. 1989, 20 (11): 1078/83. 10,1016 / 0046-8177 (89) 90226-8. Zobacz artykuł PubMed Google Scholar
  18. Nagai S Wiker HG Harboe M Kinomoto M: Izolacja i częściowa charakterystyka głównych antygenów białkowych w płynie hodowli Mycobacterium tuberculosis. Infect Immun. 1991, 59 (1): 372-382. PubMed Central PubMed Google Scholar
  19. Gutierrez CMM Garcia M, J, K: Porównanie barwienia Ziehl-Neelsen i immunohistochemicznych do wykrywania Mycobacterium bovis u bydła i kóz gruźlicy zmian. J Comp Pathol. 1993, 109: 361-370. Zobacz artykuł Google Scholar
  20. Arrese JE, Pierard GE: Immunowybarwianie różnych mikroorganizmów przez poliklonalnego przeciw Mycobacterium bovis. J Am Acad Dermatol. 1998, 39 (5 ​​Pt 1): 810- Zobacz artykuł PubMed Google Scholar
  21. Kutzner H Argenyi ZB, Requena L, Rutten A Hugel H: nowa aplikacja przeciwciała BCG do szybkiego skriningu różnych mikroorganizmów tkanek. J Am Acad Dermatol. 1998, 38 (1): 56-60. 10,1016 / S0190-9622 (98) 70539-0. Zobacz artykuł PubMed Google Scholar
  22. Closs O Harboe M, Axelsen NH, Pęczek-Christensen K, Magnusson M: Antygeny Mycobacterium bovis szczepu BCG, badane przez przekreślonego immunoelektroforezy: system odniesienia. Scand J Immunol. 1980, 12 (3): 249-263. 10.1111 / j.1365-3083.1980.tb00065.x. Zobacz artykuł PubMed Google Scholar
  23. Haines DM, Chelack BJ: względy techniczne opracowanie enzymów immunohistochemicznych procedur barwienia utrwalonych w formalinie i zatopionych w parafinie tkanek do patologii diagnostycznych. J Vet Diagn Invest. 1991, 3 (1): 101-112. Zobacz artykuł PubMed Google Scholar
  24. Kobayashi K, Blaser MJ Brown WR: Badanie immunohistochemiczne na prątki w tkankach jelita od pacjentów z chorobą Leśniowskiego-Crohna. Gastroenterologia. 1989, 96 (4): 1009/15. PubMed Google Scholar
  25. Goel MM, Ranjan V Dhole TN, Srivastava AN, Mehrotra A Kushwaha MR, Jain A: Reakcja łańcuchowa polimerazy w porównaniu z konwencjonalnym diagnozy w drobnych przydechowych igieł gruźliczego węzłów chłonnych. Acta Cytol. 2001, 45 (3): 333-340. Zobacz artykuł PubMed Google Scholar
  26. Borków G, Weisman Z, Leng Q Stein M, Kalinkovich A Wolday D Bentwich Z: robaki, ludzki wirus niedoboru odporności i gruźlicy. Scand J Infect Dis. 2001, 33 (8): 568-571. 10,1080 / 00365540110026656. Zobacz artykuł PubMed Google Scholar
  27. Li JYWMS Lo STHMS Ng CSFRCP: Wykrywanie molekularna Mycobacterium tuberculosis w tkankach Pokazuje ziarniniakowate Zapalenie Bez się udowodnić prątków kwasoopornych. [Artykuł]. Diagnostic Molecular Pathology czerwca 2000; 9 (2): 67-74 Zobacz artykuł Google Scholar
  28. Cheng VC Yam WC Hung IF Woo PC Lau SK Tang BS, Yuen KY: Ocena kliniczna reakcji łańcuchowej polimerazy do szybkiej diagnozy gruźlicy. J Clin Pathol. 2004, 57 (3): 281-285. 10,1136 / jcp.2003.012658. PubMed Central Zobacz artykuł PubMed Google Scholar
  29. Azowskiego AG, Koch J, Hamilton-Dutoit SJ: Lepsza diagnostyka zakażeń prątkami w sekcjach utrwalonych w formalinie i zatopionych w parafinie z zagnieżdżonej reakcji łańcuchowej polimerazy. APMIS. 2005, 113 (9): 586-593. 10.1111 / j.1600-0463.2005.apm_234.x. Zobacz artykuł PubMed Google Scholar
  30. Sumi MG, Mathai A Sheela R Radhakrishnan NS, Radhakrishnan VV, Indhulekshmy R Mundayoor S: narzędzie diagnostyczne reakcji łańcuchowej polimerazy i technik immunohistochemicznych w diagnostyce laboratoryjnej wewnątrzczaszkowego tuberculoma. Clin Neuropathol. 2001, 20 (4): 176-180. PubMed Google Scholar

Prawo autorskie

Ten artykuł jest publikowany w ramach licencji na BioMed Central Ltd. To jest artykuł Open Access rozpowszechniany na warunkach licencji Creative Commons Attribution (http://creativecommons.org/licenses/by/2.0), która pozwala na nieograniczone korzystanie, dystrybucję, i reprodukcja na każdym nośniku, pod warunkiem, że oryginalne dzieło jest prawidłowo cytowane.

RELATED POSTS

  • Rak krtani Diagnoza, diagnoza raka krtani.

    Oprócz sprawdzania ogólne oznaki zdrowia, lekarz będzie dokładnie czuć szyi, aby sprawdzić grudek, obrzęk, tkliwość lub innych zmian. Lekarz może również spojrzeć na krtani na dwa sposoby:…

  • Rak płuc, powoduje, testy, diagnoza …

    Rak płuc to grupa nowotworów, które mają wpływ na płuca. Wbrew powszechnemu przekonaniu nie tylko wpływa na palaczy, ale może dotknąć każdego. Jest najczęstszą postacią raka w Stanach…

  • Pleśń Choroba Diagnoza & Co …

    Ostrego i przewlekłego bólu, zespołu odpowiedzi zapalnej uzyskano w wyniku ekspozycji na środowisko wewnętrzne z wody uszkodzenia budynku przebywającym organizmów toksycznego, w tym, ale nie…

  • Objawy nerwowe zatrzymujące, Diagnoza …

    Testy diagnostyczne mogą zawierać specjalne testy sprawdzające nerwy i mięśnie. Należą do nich elektromiografii, który sprawdza ruch mięśni i test prędkości przewodzenia nerwów, które…

  • Hodgkina s objawów choroby, diagnoza …

    Choroba Hodgkina Wprowadzenie Choroba Hodgkina jest typem chłoniaka. ogólna nazwa dla grupy nowotworów krwi, które pochodzą z gruczołów chłonnych. Gruczołów chłonnych narządów układu…

  • Diagnoza HPV u kobiet

    Zdrowa ciąża blog został już na emeryturze. Doceniamy mądrość i wsparcie dr Warnock przyniósł społeczności WebMD przez lata. Otrzymuj najświeższe informacje na temat ciąży na zdrowie i dziecko…

Comments are closed.